PARANOiD Outputs

Explanation of all outputs generated by PARANOiD

Alignments

Directory that contains deduplicated alignments in BAM format together with an index file in BAM.BAI format. BAM files are compressed binary forms of SAM files. SAM/BAM files are tab separated and show one alignment per line. The information shown by the columns go as follows: 1. Read header 2. Bitwise FLAG 3. Name of reference sequence 4. Position of alignment (1-based) 5. MAPQ-score 6. CIGAR string 7. Name of mate read (shows * if information is not available) 8. Position of mate read (shows 0 if information is not available) 9. Length of alignment on the reference (shows 0 if information is not available) 10. Read sequence (shows * if information is not available) 11. Quality of read sequence (shows * if information is not available)

One of each is generated per sample.

Is included in the basic analysis.

Example:

NB501399:129:HLW7VAFX2:3:11409:5471:17963_AAGACACTG     272     1       14572   0       23M     *       0       0       CCACACAGTGCTGGTTCCGTCAC EEEEEEEEEEEAEEEEEEEEEEE NH:i:7  HI:i:4  AS:i:22 nM:i:0
NB501399:129:HLW7VAFX2:3:11604:9407:1314_TCTGCCCAC      272     1       14747   0       36M     *       0       0       CGGCAGAGGAGGGATGGAGTCTGACACGCGGGCAAA    EEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEE    NH:i:5  HI:i:4  AS:i:35 nM:i:0
NB501399:129:HLW7VAFX2:2:11201:6526:7382_TCCCCGACC      272     1       14847   0       40M     *       0       0       AGTGAGGGTGGTTGGTGGGAAACCCTGGTTCCCCCAGCCC        EEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEE        NH:i:6  HI:i:3  AS:i:39 nM:i:0
NB501399:129:HLW7VAFX2:1:11204:3841:14476_GCGATCCCG     272     1       14992   0       37M     *       0       0       GTTGAAGAGATCCGACATCAAGTGCCCACCTTGGCTC   EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE   NH:i:8  HI:i:5  AS:i:36 nM:i:0
NB501399:129:HLW7VAFX2:2:11204:16119:17944_CACACCCCG    272     1       14992   0       37M     *       0       0       GTTGAAGAGATCCGACATCAAGTGCCCACCTTGGCTC   EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE   NH:i:8  HI:i:5  AS:i:36 nM:i:0
NB501399:129:HLW7VAFX2:1:21211:6880:4260_CCACAACTC      272     1       15923   0       1S25M659N10M    *       0       0       GACCACTTCCCTGGGAGCTCCCTGGACTGAAGGAGA    AEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE    NH:i:7  HI:i:3  AS:i:35 nM:i:0

Cross link sites peak called

Raw cross link sites

Directory that contains unmodified cross-link sites with all background noise remaining. Cross-link sites are provided in 3 different formats, which are separated in one directory each; WIG, BIGWIG and BEDGRAPH. Each format represents the same data. Is included in the basic analysis.

WIG (Wiggle)

Format to represent genome-wide coverage that consists of one line per reference chromosome with the coverage listed below each in a tab separated manner. Column 1 represents the position while column 2 represents the coverage at the current position. For each sample 2 WIG files are generated - one representing cross-link events on the forward ond one on the reverse string which can be distinguished by the name. The amount of cross-link events on the reverse strand is displayed as negative.

variableStep chrom=reference_1 span=1
  1.0
  1.0
  1.0
  1.0
  1.0
variableStep chrom=reference_2 span=1
1.0
1.0
1.0
1.0

BIGWIG

An extension of the previously mentioned WIG format. While WIG uses plain text BIGWIG uses a binary format to store the data, reducing the file size. Therefore, accessing the data requires specialized software such as the IGV.

BEDGRAPH

Similar format to WIG or BIGWIG. BEDGRAPH files consist of 4 columns: 1. The chromosome name 2. The start position of the described events 3. The end position of the described events (for PARANOiD this is the position of the actual cross-link event) 4. Coverage of currently described event (negative for reverse strand)

DQ375404.1  2814    2815    1
DQ375404.1  3725    3726    1
DQ375404.1  3894    3895    1
DQ375404.1  6200    6201    1
DQ375404.1  6366    6367    1
DQ380154.1  21      22      1
DQ380154.1  30      31      1
DQ380154.1  65      66      1
DQ380154.1  79      80      1

Visualization with IGV

All provided file types can be easily visualized via the Integrative Genomics Viewer (IGV). To do so first the reference sequences need to be loaded into IGV. This is done by clicking on the tab called Genomes - which is located on the top left corner - and then choose the origin of the reference genome.

The reference track can be used to zoom in allowing users to see cross-link sites more detailed.

Cross link sites merged

Execution metrics

Directory that contains general execution metrics of the workflow such as:

container_information.txt
Container system used to execute the processes together with the containers that were used during the workflow
execution_information.txt
Contains information necessary to reproduce the results such as
Command used for the execution

Directory of PARANOiD

Config file used

Profiles used

Version od Nextflow and PARANOiD

Execution directory
parameter_information.txt
Contains all parameters used

Is included in the basic analysis.

IGV-session

An XML file that can be transferred directly to the IGV. This can be done by clicking on the data tab on the top left and then on Open Session. A window will open in which you can navigate to the output directory of PARANOiD and choose igv-session.xml. This will open a predefined IGV session that includes the reference, the cross-link sites of all samples (forward and reverse) and the alignment files of all samples. If the option --merge_replicates was chosen then only the merged cross-link sites are shown. Is included in the basic analysis.

Peak height distribution

Is included in the basic analysis.

Reference

The reference sequence provided as input.

Is included in the basic analysis.

Statistics

Is included in the basic analysis.

Strand distribution

Is included in the basic analysis.